LOC557524

Ensembl ID:
ENSDARG00000031618
Human Orthologue:
SBK1
Human Description:
SH3-binding domain kinase 1 [Source:HGNC Symbol;Acc:17699]
Mouse Orthologue:
Sbk1
Mouse Description:
SH3-binding kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2135937]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1261 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042386 Nonsense 236 409 3 3
Genomic Location:
Chromosome 3 (position 59375768)
KASP Assay ID:
554-1176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCATTTGGCGTGCTTCTGTTCTGCATGCTCACCGGGAATTTCCCCTGG[G/T]AGAAAGCGCTGCCCTCGGATGCTTTCTACGAGGAGTTTGTGCGCTGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hdo0nmpc