g6pca

Ensembl ID:
ENSDARG00000031616
ZFIN ID:
ZDB-GENE-031001-4
Description:
glucose-6-phosphatase a, catalytic [Source:RefSeq peptide;Acc:NP_001003512]
Human Orthologue:
G6PC
Human Description:
glucose-6-phosphatase, catalytic subunit [Source:HGNC Symbol;Acc:4056]
Mouse Orthologue:
G6pc
Mouse Description:
glucose-6-phosphatase, catalytic Gene [Source:MGI Symbol;Acc:MGI:95607]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35207 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032050 Nonsense 197 353 7 7
ENSDART00000106435 Nonsense 196 347 6 7
ENSDART00000130159 Nonsense 196 348 6 7
ENSDART00000131301   None 133 None 4
ENSDART00000139419 Nonsense 196 352 6 6
Genomic Location (Zv9):
Chromosome 12 (position 6707598)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5990518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTATTTCCAGGTATAATTGTAGCAGAAACCTTCTCCAGAGTGCAGTG[G/A]ATCTATAGTGCGAGTCTGAAGAAGTACTTCAGCATCACGCTGTTCCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link