calb1

Ensembl ID:
ENSDARG00000031598
ZFIN ID:
ZDB-GENE-030131-8107
Human Orthologue:
CALB1
Human Description:
calbindin 1, 28kDa [Source:HGNC Symbol;Acc:1434]
Mouse Orthologue:
Calb1
Mouse Description:
calbindin 1 Gene [Source:MGI Symbol;Acc:MGI:88248]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045190 Nonsense 244 271 12 12
ENSDART00000145697 Nonsense 233 260 11 11

The following transcripts of ENSDARG00000031598 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 38172227)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36812710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTTCTCATCTCCGACAGGTTCTAGAAGCCAACAAAATCTCCACGTA[T/G]AAGAGTGCCATCATGGCTCTGTCCGACGGAGGCAAGCTCTACAGAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link