ENSDARG00000031588

Ensembl ID:
ENSDARG00000031588

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35365 Nonsense Mutation detected in F1 DNA During 2016
sa30965 Nonsense Mutation detected in F1 DNA During 2016
sa42089 Nonsense Mutation detected in F1 DNA During 2016
sa42090 Nonsense Mutation detected in F1 DNA During 2016
sa28005 Nonsense Mutation detected in F1 DNA During 2016
sa35366 Nonsense Mutation detected in F1 DNA During 2016
sa42091 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42092 Nonsense Mutation detected in F1 DNA During 2016
sa35367 Nonsense Mutation detected in F1 DNA During 2016
sa35368 Nonsense Mutation detected in F1 DNA During 2016
sa11301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2081 5333 24 61
Genomic Location (Zv9):
Chromosome 12 (position 40497652)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38779395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATGGAATTTCATCAGTCATCTATTTTCTACGACCATTCATATTTTTT[G/T]AACAGACATACAACCAAGTATATGTAAGTGATTATGGTATGATTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2340 5333 28 61
ENSDART00000063760 Nonsense 2340 5333 28 61
Genomic Location (Zv9):
Chromosome 12 (position 40499126)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38780869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGGTGATCCTCACTACTACACCTTTGACTATCAAGTTTTTCACTTT[C/T]AAGGGACCTGCACATACGTTCTATCTGAGGTTTGAATTTATAGTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2340 5333 28 61
ENSDART00000063760 Nonsense 2340 5333 28 61
Genomic Location (Zv9):
Chromosome 12 (position 40499126)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38780869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGGTGATCCTCACTACTACACCTTTGACTATCAAGTTTTTCACTTT[C/T]AAGGGACCTGCACATACGTTCTATCTGAGGTTTGAATTTATAGTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2358 5333 29 61
Genomic Location (Zv9):
Chromosome 12 (position 40499263)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38781006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTTTAAAATTCATTGTTTAGGCTTGCAACAATGGATTGCCATACTA[T/A]CGCATTGAGGGCAAAAATGAGCATAGGGGTAGCACGCATGTCTCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2496 5333 30 61
Genomic Location (Zv9):
Chromosome 12 (position 40499761)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38781504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGTGGACTTTGCCAACAGTTGGAAAGTAGATAGTGACACAGACCCT[G/T]AGTGCCATAATGTCAGGTGCACAGGTCTGGCTTGTGCCGTTTGCACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2578 5333 30 61
Genomic Location (Zv9):
Chromosome 12 (position 40500007)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38781750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAATTTTGTGCCAGGCTCTGAATGTGTATGCCACTCAGTGCCAACAA[C/T]AAGGTGTACACCTTGGGCAGTGGAGGCAGCAAGGATTTTGTGGTAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Essential Splice Site 2974 5333 32 61
Genomic Location (Zv9):
Chromosome 12 (position 40501455)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38783198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAGAATAGAATTGCAGTAGAAGACTGGAGAAATGTCACCAACTGTG[G/A]TCAGCATCTTGTTTTGAATGTGTGAACCTAAAACTTGCATTCATGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 3044 5333 33 61
Genomic Location (Zv9):
Chromosome 12 (position 40501760)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38783503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCATGGGTTGTGGTTGTCACTACTCTGGGAAGTATTATCAGGCTGGA[C/T]AGAGATTCTGGCATGGTGAAGAGTGCCAGTTCTCCTGTGTTTGTGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 3410 5333 35 61
Genomic Location (Zv9):
Chromosome 12 (position 40503308)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38785051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCTCAGAGGGATGTTTCTGTAATGATGGATTGGTCAGGAGTGGAGGA[C/T]AGTGTGTATCGGTGGAGCAATGCGGCTGCTCGTATGATGGATTCTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 3920 5333 45 61
Genomic Location (Zv9):
Chromosome 12 (position 40507021)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38788764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATGACTATCAGAATACCACCTGTGGTCTGTGTGGAAACTATAACCTG[C/T]AATCTGATGATGACTTCCATTCACCCAGTGGGGAGATCTTGAGCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 4362 5333 47 61
Genomic Location (Zv9):
Chromosome 12 (position 40508563)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38790306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACAGCTGGGAGCCAGGACAGTTTCAGAGCAGGAGCCAGTTCAGTCAA[C/T]AGTGTGGTATCATGGCTWTGCTTGATGGACCATTCGCTGAGTGCAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link