ENSDARG00000031588

Ensembl ID:
ENSDARG00000031588

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30965 Nonsense Mutation detected in F1 DNA During 2015
sa28005 Nonsense Mutation detected in F1 DNA During 2015
sa11301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2340 5333 28 61
Genomic Location:
Chromosome 12 (position 40499126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGGTGATCCTCACTACTACACCTTTGACTATCAAGTTTTTCACTTT[C/T]AAGGGACCTGCACATACGTTCTATCTGAGGTTTGAATTTATAGTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 2496 5333 30 61
Genomic Location:
Chromosome 12 (position 40499761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGTGGACTTTGCCAACAGTTGGAAAGTAGATAGTGACACAGACCCT[G/T]AGTGCCATAATGTCAGGTGCACAGGTCTGGCTTGTGCCGTTTGCACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063760 Nonsense 4362 5333 47 61
Genomic Location:
Chromosome 12 (position 40508563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACAGCTGGGAGCCAGGACAGTTTCAGAGCAGGAGCCAGTTCAGTCAA[C/T]AGTGTGGTATCATGGCTWTGCTTGATGGACCATTCGCTGAGTGCAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t0ymflfp