Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa35365 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa30965 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42089 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42090 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa28005 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35366 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42091 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa42092 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35367 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35368 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa11301 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa35365
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
2081 |
5333 |
24 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40497652)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38779395 |
GRCz11 |
12 |
38953896 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGATGGAATTTCATCAGTCATCTATTTTCTACGACCATTCATATTTTTT[G/T]AACAGACATACAACCAAGTATATGTAAGTGATTATGGTATGATTTTCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30965
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 12 (position 40499126)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38780869 |
GRCz11 |
12 |
38955370 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCTGGTGATCCTCACTACTACACCTTTGACTATCAAGTTTTTCACTTT[C/T]AAGGGACCTGCACATACGTTCTATCTGAGGTTTGAATTTATAGTTTTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42089
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 12 (position 40499126)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38780869 |
GRCz11 |
12 |
38955370 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCTGGTGATCCTCACTACTACACCTTTGACTATCAAGTTTTTCACTTT[C/T]AAGGGACCTGCACATACGTTCTATCTGAGGTTTGAATTTATAGTTTTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42090
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
2358 |
5333 |
29 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40499263)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38781006 |
GRCz11 |
12 |
38955507 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTTTTTAAAATTCATTGTTTAGGCTTGCAACAATGGATTGCCATACTA[T/A]CGCATTGAGGGCAAAAATGAGCATAGGGGTAGCACGCATGTCTCTTGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28005
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
2496 |
5333 |
30 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40499761)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38781504 |
GRCz11 |
12 |
38956005 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGATGTGGACTTTGCCAACAGTTGGAAAGTAGATAGTGACACAGACCCT[G/T]AGTGCCATAATGTCAGGTGCACAGGTCTGGCTTGTGCCGTTTGCACCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35366
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
2578 |
5333 |
30 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40500007)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38781750 |
GRCz11 |
12 |
38956251 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCAATTTTGTGCCAGGCTCTGAATGTGTATGCCACTCAGTGCCAACAA[C/T]AAGGTGTACACCTTGGGCAGTGGAGGCAGCAAGGATTTTGTGGTAGGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42091
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Essential Splice Site |
2974 |
5333 |
32 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40501455)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38783198 |
GRCz11 |
12 |
38957699 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAACAGAATAGAATTGCAGTAGAAGACTGGAGAAATGTCACCAACTGTG[G/A]TCAGCATCTTGTTTTGAATGTGTGAACCTAAAACTTGCATTCATGTCAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42092
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
3044 |
5333 |
33 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40501760)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38783503 |
GRCz11 |
12 |
38958004 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCCATGGGTTGTGGTTGTCACTACTCTGGGAAGTATTATCAGGCTGGA[C/T]AGAGATTCTGGCATGGTGAAGAGTGCCAGTTCTCCTGTGTTTGTGATGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35367
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
3410 |
5333 |
35 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40503308)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38785051 |
GRCz11 |
12 |
38959552 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGCTCAGAGGGATGTTTCTGTAATGATGGATTGGTCAGGAGTGGAGGA[C/T]AGTGTGTATCGGTGGAGCAATGCGGCTGCTCGTATGATGGATTCTACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35368
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
3920 |
5333 |
45 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40507021)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38788764 |
GRCz11 |
12 |
38963265 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATATGACTATCAGAATACCACCTGTGGTCTGTGTGGAAACTATAACCTG[C/T]AATCTGATGATGACTTCCATTCACCCAGTGGGGAGATCTTGAGCTCAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11301
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000063760 |
Nonsense |
4362 |
5333 |
47 |
61 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40508563)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
38790306 |
GRCz11 |
12 |
38964807 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTGACAGCTGGGAGCCAGGACAGTTTCAGAGCAGGAGCCAGTTCAGTCAA[C/T]AGTGTGGTATCATGGCTWTGCTTGATGGACCATTCGCTGAGTGCAGCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: