tada2a

Ensembl ID:
ENSDARG00000031562
ZFIN ID:
ZDB-GENE-060929-508
Description:
transcriptional adapter 2-alpha [Source:RefSeq peptide;Acc:NP_001070609]
Human Orthologue:
TADA2A
Human Description:
transcriptional adaptor 2A [Source:HGNC Symbol;Acc:11531]
Mouse Orthologue:
Tada2a
Mouse Description:
transcriptional adaptor 2A Gene [Source:MGI Symbol;Acc:MGI:2144471]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22601 Nonsense Available for shipment Available now
sa42511 Nonsense Mutation detected in F1 DNA During 2016
sa35833 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 118 421 5 14
ENSDART00000130670 Nonsense 118 445 5 15
Genomic Location (Zv9):
Chromosome 15 (position 14809958)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15854921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGCTCTAAAACCAAAGAAGAATGTGAAGGTCACTACATGAAGAACTA[T/A]ATCAACAATCCTCTGTTCTCCTCCACTCTGCTCAGTCTCAGACATATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 149 421 5 14
ENSDART00000130670 Nonsense 149 445 5 15
Genomic Location (Zv9):
Chromosome 15 (position 14810049)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15855012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATATGGATGATCATCTGTCCCGGACAGCAGACACAGCCATTCCCTTC[A/T]AGCGTAAGTGAGCAGCAAAAACAACAGAAGCAACTGTTGTGTGATTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 372 421 14 14
ENSDART00000130670 Nonsense 396 445 15 15
Genomic Location (Zv9):
Chromosome 15 (position 14838207)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15883170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGTCGCTCAGCTGTGTCAGGTGGTGCGGCTGGTGCCCGGGGCGTA[T/A]CTGGAGTACAAACAAGCCCTGCTGAATGAGTGCCGGCGGCAGGGGGGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link