ephb3a

Ensembl ID:
ENSDARG00000031548
ZFIN ID:
ZDB-GENE-990415-60
Description:
Ephrin type-B receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:O13147]
Human Orthologue:
EPHB3
Human Description:
EPH receptor B3 [Source:HGNC Symbol;Acc:3394]
Mouse Orthologue:
Ephb3
Mouse Description:
Eph receptor B3 Gene [Source:MGI Symbol;Acc:MGI:104770]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18039 Nonsense Available for shipment Available now
sa19673 Nonsense Available for shipment Available now
sa5122 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19672 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040209 Nonsense 117 925 3 16
ENSDART00000048840 None None 499 None 12
Genomic Location:
Chromosome 2 (position 7779713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCCAACATCCCCGGTTCCTGTAAAGAGAMCTTTAATCTGTTCTACTA[T/A]GAATCAGACGGAGACATGGCCACGGCAAGCAGCCCACCGTGGAGGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040209 Nonsense 504 925 8 16
ENSDART00000048840 Nonsense 42 499 3 12
Genomic Location:
Chromosome 2 (position 7759413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCAAAGTGGAGGGTTTGAAGGCTGGCACGGTGTACTCTGTGCAGGTT[C/T]GAGCTCGGACGGTAGCTGGGTATGGACGGTATAGCAACCCGGTGGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040209 Essential Splice Site 579 925 10 16
ENSDART00000048840 Essential Splice Site 153 499 6 12
Genomic Location:
Chromosome 2 (position 7743624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCGTACTGGATCAGAGCTGGAGTACACTGAAAAACTRCAGCAGTACG[G/A]TGAGTTCATCTTCTGCACRCACTGCTTGCCAGAAATCTTTCTTGCTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040209 Nonsense 808 925 14 16
ENSDART00000048840 Nonsense 382 499 10 12
Genomic Location:
Chromosome 2 (position 7721495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGTTCACCTCTGCCAGCGACGTGTGGAGCTATGGCATTGTGATGTG[G/A]GAAGTAATGTCATTCGGAGAGCGGCCGTACTGGGACATGAGTAATCAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k46waxgb