si:ch211-45m15.5

Ensembl ID:
ENSDARG00000031540
ZFIN ID:
ZDB-GENE-040724-81
Description:
Transmembrane protein 200A [Source:UniProtKB/Swiss-Prot;Acc:Q5RGQ8]
Human Orthologue:
TMEM200A
Human Description:
transmembrane protein 200A [Source:HGNC Symbol;Acc:21075]
Mouse Orthologue:
Tmem200a
Mouse Description:
transmembrane protein 200A Gene [Source:MGI Symbol;Acc:MGI:1924470]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36941 Nonsense Mutation detected in F1 DNA During 2017
sa43367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041250 Nonsense 23 497 1 1
Genomic Location (Zv9):
Chromosome 20 (position 2259433)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2213718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGATCACAGGCCTTGCAGCATTGAAAAGGCAAGACTCCACACGCTCT[C/T]AGTATCATCTGTCAGCCCAGAGCCCCGGCCCGGCACCTGAGAAGAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041250 Nonsense 248 497 1 1
Genomic Location (Zv9):
Chromosome 20 (position 2260110)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2214395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGATGATGATGATGGTTTAATGAGCGAGGCTAGAGGTGGATTTTG[T/A]TTGCTGTCGCCCACCTATAAGGACCGCTCTGAATGTATATTCGGGTTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link