LOC563812

Ensembl ID:
ENSDARG00000031534
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40038 Nonsense Mutation detected in F1 DNA During 2016
sa8364 Nonsense Mutation detected in F1 DNA During 2016
sa19982 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079333 Nonsense 142 470 2 7
Genomic Location:
Chromosome 3 (position 19370722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATTTTCACTTTAACTTCTAGGAGCAGCTCAAAACAGAACTGAGGTA[T/A]TTAAAGGGGGATCTTCAACAGAGAGAATGGGTGAAAGTAGCATTTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079333 Nonsense 149 470 2 7
Genomic Location:
Chromosome 3 (position 19370703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGGAGCAGCTCAAAACAGAACTGAGGTATTTAAAGGGGGATCTTCAA[C/T]AGAGAGAATGGGTGAAAGTAGCATTTGAGAAAACTGWTCAACACATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079333 Essential Splice Site 289 470 5 7
Genomic Location:
Chromosome 3 (position 19366467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTTTCATTCAGAGTCTGCAATAAGATGCAGGACATCGTGCAATACA[G/A]TGAGTCTGGACTTATGCACCAATACGTTTTACAGATTTATAACGTCTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link