si:ch211-119b12.6

Ensembl ID:
ENSDARG00000031506
ZFIN ID:
ZDB-GENE-041210-312
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RG90]
Human Orthologue:
FLVCR2
Human Description:
feline leukemia virus subgroup C cellular receptor family, member 2 [Source:HGNC Symbol;Acc:20105]
Mouse Orthologue:
Mfsd7c
Mouse Description:
major facilitator superfamily domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2384974]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15497 Nonsense Available for shipment Available now
sa12161 Nonsense Available for shipment Available now
sa18148 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038696 Nonsense 309 495 4 11
ENSDART00000142092 Nonsense 277 465 4 9
ENSDART00000038696 Nonsense 309 495 4 11
ENSDART00000142092 Nonsense 277 465 4 9
Genomic Location (Zv9):
Chromosome 20 (position 46575703)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46420986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTYTATGCTGTCAGTACACTTCTCAACMGGATGATCATTGAACACTA[T/A]CCTGTAAGTCCCTCCCACTCATCAGCTATCCGGCCAATTATGAGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038696 Nonsense 309 495 4 11
ENSDART00000142092 Nonsense 277 465 4 9
ENSDART00000038696 Nonsense 309 495 4 11
ENSDART00000142092 Nonsense 277 465 4 9
Genomic Location (Zv9):
Chromosome 20 (position 46575703)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46420986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTYTATGCTGTCAGTACACTTCTCAACMGGATGATCATTGAACACTA[T/A]CCTGTAAGTCCCTCCCACTCATCAGCTATCCGGCCAATTATGAGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038696 Nonsense 469 495 9 11
ENSDART00000142092 Nonsense 437 465 9 9
Genomic Location (Zv9):
Chromosome 20 (position 46590648)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46435931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCTCAGGCTGTATAAAGTCAGATCTGCGCAGACAGCTGGCAAACCAG[C/T]AAGCACAAACTGCTGTAAGTATCAAAGTATCCAACCAGAAGGTCATGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link