LOC100332265

Ensembl ID:
ENSDARG00000031496
Human Orthologue:
AP1AR
Human Description:
adaptor-related protein complex 1 associated regulatory protein [Source:HGNC Symbol;Acc:28808]
Mouse Orthologue:
Ap1ar
Mouse Description:
adaptor-related protein complex 1 associated regulatory protein Gene [Source:MGI Symbol;Acc:MGI:2384

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12129 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041468 Nonsense 263 293 10 10
Genomic Location:
Chromosome 14 (position 4820412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGGAGTGGGAAAATGACTTTGTGAGTGCTCATCCTGACGAMAGC[G/T]GAGAACACGAAGACTCTGCTGGATTGGTTAATCCAGCKCTGGACACGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zcipw5o0