bat2

Ensembl ID:
ENSDARG00000031494
ZFIN ID:
ZDB-GENE-010501-4
Human Orthologue:
BAT2
Human Description:
HLA-B associated transcript 2 [Source:HGNC Symbol;Acc:13918]
Mouse Orthologue:
Bat2
Mouse Description:
HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23536 Nonsense Mutation detected in F1 DNA During 2014
sa15913 Nonsense Available for shipment Available now
sa23535 Nonsense Mutation detected in F1 DNA During 2014
sa23534 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 429 1892 10 15
ENSDART00000138675 Nonsense 427 1890 11 16
Genomic Location:
Chromosome 19 (position 27234174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGTACCTGTTTCACGTTCCAGGGCATCCGACAGTGGAGGGGATTCG[C/T]GACGCACCCCTCCTTCCAGTACTGAAGATGGCTCTGTGTCCCCCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1130 1892 15 15
ENSDART00000138675 Nonsense 1128 1890 16 16
Genomic Location:
Chromosome 19 (position 27230858)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGASAAGACAGGAAATGCGCATAATCAGCCCCCACAAMATTCTGGG[C/T]AGCAGCACCACCCTAGAGCCAACCCTCGCAAYCGGGAACACAAAACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1353 1892 15 15
ENSDART00000138675 Nonsense 1351 1890 16 16
Genomic Location:
Chromosome 19 (position 27230189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGCTATAGGGGCACTTACGTGGGTAGTGCAGGTGGTGGCAACCGT[G/T]GAAAGGCTGGTGGCAGGAACAGCAGGGATTATAGGCCAGCTGCCAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1558 1892 15 15
ENSDART00000138675 Nonsense 1556 1890 16 16
Genomic Location:
Chromosome 19 (position 27229574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAGCCGTGGAGTGAATGTTGACAAGAAGAAACCTGCAGAACAGAAT[C/T]AGCCTCAAAGTCAAAGTGCAAATCCCACCACAACTGTTGCCTCTGTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5650uayl