bat2

Ensembl ID:
ENSDARG00000031494
ZFIN ID:
ZDB-GENE-010501-4
Human Orthologue:
BAT2
Human Description:
HLA-B associated transcript 2 [Source:HGNC Symbol;Acc:13918]
Mouse Orthologue:
Bat2
Mouse Description:
HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43293 Nonsense Mutation detected in F1 DNA During 2016
sa23536 Nonsense Available for shipment Available now
sa43292 Nonsense Mutation detected in F1 DNA During 2016
sa15913 Nonsense Available for shipment Available now
sa43291 Nonsense Mutation detected in F1 DNA During 2016
sa23535 Nonsense Mutation detected in F1 DNA During 2016
sa36848 Nonsense Mutation detected in F1 DNA During 2016
sa23534 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 392 1892 9 15
ENSDART00000138675 Nonsense 390 1890 10 16
Genomic Location (Zv9):
Chromosome 19 (position 27234362)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27164474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCGAAGTTGAAATTCAGTGACGATGAAGGAGAGGATGATGGGGAGGAG[G/T]AACGGGGTGAAAATAAAAATGGAACCCGGTAAACATTTCTAAAATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 429 1892 10 15
ENSDART00000138675 Nonsense 427 1890 11 16
Genomic Location (Zv9):
Chromosome 19 (position 27234174)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27164286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGTACCTGTTTCACGTTCCAGGGCATCCGACAGTGGAGGGGATTCG[C/T]GACGCACCCCTCCTTCCAGTACTGAAGATGGCTCTGTGTCCCCCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 718 1892 12 15
ENSDART00000138675 Nonsense 716 1890 13 16
Genomic Location (Zv9):
Chromosome 19 (position 27232784)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27162896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGGACGGCAGGGAAGTGGTCCTTCTGGGCAAGGCTTTTCCAAGTAT[C/T]AAAAATCGCTTCCTCCTCGCTTTCAGAGGCAACAACAGGTTGGTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1130 1892 15 15
ENSDART00000138675 Nonsense 1128 1890 16 16
Genomic Location (Zv9):
Chromosome 19 (position 27230858)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27160970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGASAAGACAGGAAATGCGCATAATCAGCCCCCACAAMATTCTGGG[C/T]AGCAGCACCACCCTAGAGCCAACCCTCGCAAYCGGGAACACAAAACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1233 1892 15 15
ENSDART00000138675 Nonsense 1231 1890 16 16
Genomic Location (Zv9):
Chromosome 19 (position 27230549)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27160661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGGAGGAGGAGAAAAGACTACTGGAGGCTCTGGTAAAGATAAAGAA[C/T]AAGATGCAAGTCAAACCACAACCAAACAAGAACCTGCCACTGGGAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1353 1892 15 15
ENSDART00000138675 Nonsense 1351 1890 16 16
Genomic Location (Zv9):
Chromosome 19 (position 27230189)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27160301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGCTATAGGGGCACTTACGTGGGTAGTGCAGGTGGTGGCAACCGT[G/T]GAAAGGCTGGTGGCAGGAACAGCAGGGATTATAGGCCAGCTGCCAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1531 1892 15 15
ENSDART00000138675 Nonsense 1529 1890 16 16
Genomic Location (Zv9):
Chromosome 19 (position 27229655)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27159767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCTTCCCATGGCTGGTCGGCAAAGTCTGCAAATGTGCGAAAGCCA[C/T]AGACATCCTCACAGCCACCCCCTGCTAAAGATTTAAGCCGTGGAGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043776 Nonsense 1558 1892 15 15
ENSDART00000138675 Nonsense 1556 1890 16 16
Genomic Location (Zv9):
Chromosome 19 (position 27229574)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27159686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAGCCGTGGAGTGAATGTTGACAAGAAGAAACCTGCAGAACAGAAT[C/T]AGCCTCAAAGTCAAAGTGCAAATCCCACCACAACTGTTGCCTCTGTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link