col9a1

Ensembl ID:
ENSDARG00000031483
ZFIN ID:
ZDB-GENE-040426-2410
Description:
collagen type IX alpha I [Source:RefSeq peptide;Acc:NP_998429]
Human Orthologue:
COL9A1
Human Description:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
Mouse Orthologue:
Col9a1
Mouse Description:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22364 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12182 Essential Splice Site Available for shipment Available now
sa4341 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 207 546 13 24
ENSDART00000131508 Essential Splice Site 342 681 21 32
Genomic Location:
Chromosome 13 (position 39701639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTGTGAGGTGGTAACCAATGGTATATACCATACTTCTTCCAATGAC[A/T]GGGTAACGCTGGACAACCAGGCCTTATTGGCACTATGGGATCTTCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
Genomic Location:
Chromosome 13 (position 39684695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGGGGGAACATCVGCACTCATTAGTGCGTYTGCTCTTTGTGCTTTC[A/T]GAGCAGTTGGCACAGTTGGCTGCCAGTCTGAGGAGMCCAGAGTCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
Genomic Location:
Chromosome 13 (position 39684695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGGGGGAACATCGGCACTCATTAGTGCGTYTGCTCTTTGTGCTTTC[A/T]GAGCAGTTGGCACAGTTGGCTGCCAGTCTGAGGAGMCCAGAGTCTGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vbh3f4ds