LOC562928

Ensembl ID:
ENSDARG00000031463
Human Orthologue:
SYT6
Human Description:
synaptotagmin VI [Source:HGNC Symbol;Acc:18638]
Mouse Orthologue:
Syt6
Mouse Description:
synaptotagmin VI Gene [Source:MGI Symbol;Acc:MGI:1859544]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41836 Nonsense Mutation detected in F1 DNA During 2017
sa38841 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048365 Nonsense 321 471 4 7
Genomic Location (Zv9):
Chromosome 11 (position 25591825)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24420650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGCAGGAGAGTGTGGATCTCGGAGAGATAATGTTCTCTCTGTGCTA[C/G]TTGCCGACTGCAGGGAGACTCACACTTACAGTCATCAAATGTAGGAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048365 Essential Splice Site 348 471 5 7
Genomic Location (Zv9):
Chromosome 11 (position 25592087)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24420912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGAAGATGTGTTGAGAAAAGTGTGTCACACCTCCCTGCTCTCTTGAC[A/T]GATCCGTACGTGAAGGTTTCGCTGATTTGTGATGGGAGACGCTTGAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link