rcor1

Ensembl ID:
ENSDARG00000031434
ZFIN ID:
ZDB-GENE-050506-79
Description:
REST corepressor 1 [Source:RefSeq peptide;Acc:NP_001073510]
Human Orthologue:
RCOR1
Human Description:
REST corepressor 1 [Source:HGNC Symbol;Acc:17441]
Mouse Orthologue:
Rcor1
Mouse Description:
REST corepressor 1 Gene [Source:MGI Symbol;Acc:MGI:106340]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104219 Nonsense 453 458 13 13
Genomic Location (Zv9):
Chromosome 17 (position 29312151)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29236078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATAATCATCAAATTATCTCTTTCAGGAACAAACGCCAATGGAAACA[C/T]AGAACCCTTCGGTTTCCTGAGTTCTCCAACAGCGGTTGGTCGAGCTCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link