csrnp1a

Ensembl ID:
ENSDARG00000031426
ZFIN ID:
ZDB-GENE-070912-475
Description:
Novel protein similar to vertebrate AXIN1 up-regulated 1 (AXUD1) [Source:UniProtKB/TrEMBL;Acc:B0S776
Human Orthologue:
CSRNP1
Human Description:
cysteine-serine-rich nuclear protein 1 [Source:HGNC Symbol;Acc:14300]
Mouse Orthologue:
Csrnp1
Mouse Description:
cysteine-serine-rich nuclear protein 1 Gene [Source:MGI Symbol;Acc:MGI:2387989]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1521 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1521
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041877 Nonsense 418 514 5 5
Genomic Location:
Chromosome 2 (position 24060695)
KASP Assay ID:
554-1445.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCACAATTGATAATSAACAATTAAAAACCAAACCMCAACTAGAGTA[T/A]CTGGATGAAAATGCCAACCAGGTCACGGTAAAATGTGTAAACGATCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ct5whvlo