igfbp2b

Ensembl ID:
ENSDARG00000031422
ZFIN ID:
ZDB-GENE-090107-3
Description:
Insulin-like growth factor-binding protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:B3F211]
Human Orthologue:
IGFBP2
Human Description:
insulin-like growth factor binding protein 2, 36kDa [Source:HGNC Symbol;Acc:5471]
Mouse Orthologue:
Igfbp2
Mouse Description:
insulin-like growth factor binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:96437]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8707 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025256 Nonsense 66 265 1 4
Genomic Location (Zv9):
Chromosome 9 (position 47794479)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46945066
KASP Assay ID:
2260-2500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGCTGTCCGGTTTGCGCCCGGCAGAWGGGYGAGCTGTGCGGGGTCTA[T/G]ACGCCGAGATGCGGCAGCGGTTTGAGGTGTTACCCGAGCGCGAATKCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link