trh1

Ensembl ID:
ENSDARG00000031387
ZFIN ID:
ZDB-GENE-020808-1
Description:
trh1 protein [Source:RefSeq peptide;Acc:NP_705956]
Human Orthologue:
LASS4
Human Description:
LAG1 homolog, ceramide synthase 4 [Source:HGNC Symbol;Acc:23747]
Mouse Orthologue:
Lass4
Mouse Description:
LAG1 homolog, ceramide synthase 4 Gene [Source:MGI Symbol;Acc:MGI:1914510]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43758 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8362 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4177 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Essential Splice Site 63 407 2 11
Genomic Location:
Chromosome 22 (position 4288795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCCCATTGGCCCTGGGGTTCATCGCCCTGCGTTTTGTATTCGAAAG[G/A]TCAGTATCAACGCCGCATATGTTTTCATTTTCATTTCTAGCGAGTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Essential Splice Site 103 407 3 11
Genomic Location:
Chromosome 22 (position 4293582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACTGGAGGCGTTCTACCTGCAGAAGAAGAAGACTGAGCCGTCACAG[G/A]TGAACAACACCTAAACACCTGACTCATTACCGCACACAYGANNNCATCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Nonsense 308 407 10 11
Genomic Location:
Chromosome 22 (position 4307719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACCGCTGTGGTGGATTCATTGRWCGTATTTTCTCCATACCCTGGCTA[T/G]TATTTCTTTAACGGCCTGTTACTGGTTCTTCAAGCTCTGCACATCTTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link