trh1

Ensembl ID:
ENSDARG00000031387
ZFIN ID:
ZDB-GENE-020808-1
Description:
trh1 protein [Source:RefSeq peptide;Acc:NP_705956]
Human Orthologue:
LASS4
Human Description:
LAG1 homolog, ceramide synthase 4 [Source:HGNC Symbol;Acc:23747]
Mouse Orthologue:
Lass4
Mouse Description:
LAG1 homolog, ceramide synthase 4 Gene [Source:MGI Symbol;Acc:MGI:1914510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43758 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Essential Splice Site 63 407 2 11
Genomic Location (Zv9):
Chromosome 22 (position 4288795)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4327608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCCCATTGGCCCTGGGGTTCATCGCCCTGCGTTTTGTATTCGAAAG[G/A]TCAGTATCAACGCCGCATATGTTTTCATTTTCATTTCTAGCGAGTCAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link