klhl38

Ensembl ID:
ENSDARG00000031383
ZFIN ID:
ZDB-GENE-060503-737
Description:
Kelch-like protein 38 [Source:UniProtKB/Swiss-Prot;Acc:Q1LYM6]
Human Orthologue:
KLHL38
Human Description:
kelch-like 38 (Drosophila) [Source:HGNC Symbol;Acc:34435]
Mouse Orthologue:
Klhl38
Mouse Description:
kelch-like 38 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5927 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052078 Essential Splice Site 488 583 3 3
Genomic Location (Zv9):
Chromosome 19 (position 34459821)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33497237
KASP Assay ID:
554-3939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGKCTGRTATGAGGATTTGAAAAACGCTGAGATTTTGTATTAAACTTTTC[A/G]GGATACACAAGAAGAGTGATCGCCTATGACACCAAAGCAAACAAATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link