efna2

Ensembl ID:
ENSDARG00000031372
ZFIN ID:
ZDB-GENE-990415-66
Description:
Ephrin-A2 [Source:UniProtKB/Swiss-Prot;Acc:P79727]
Human Orthologue:
EFNA2
Human Description:
ephrin-A2 [Source:HGNC Symbol;Acc:3222]
Mouse Orthologue:
Efna2
Mouse Description:
ephrin A2 Gene [Source:MGI Symbol;Acc:MGI:102707]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9702 Nonsense Available for shipment Available now
sa10005 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040278 Nonsense 43 195 2 4
Genomic Location:
Chromosome 2 (position 26570433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGATCTAATCCTCTGACTCTTRCTTGCAGGTTCTGGCAGGGCGAATA[T/A]ACKGTGGCTGTGAGCATCAACGACTACCTGGAYGTGTACTGTCCGTAKTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040278 Nonsense 59 195 2 4
Genomic Location:
Chromosome 2 (position 26570481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWACKGTGGCTGTGAGCATCAACGACTACCTGGAYGTGTACTGTCCGTA[T/G]TATGAGAGCCCGCAGCCGCAYAGTCGCATGGAGCGCTACATCCTCTTYAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yrl2nxi1