cmpk2

Ensembl ID:
ENSDARG00000031359
ZFIN ID:
ZDB-GENE-040724-24
Description:
Novel protein similar to mouse thymidylate kinase family LPS-inducible member (Tyki) [Source:UniProt
Human Orthologue:
CMPK2
Human Description:
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial [Source:HGNC Symbol;Acc:27015]
Mouse Orthologue:
Cmpk2
Mouse Description:
cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:99830]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4723 Nonsense Mutation detected in F1 DNA During 2014
sa7835 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045967 Nonsense 273 414 3 5
ENSDART00000137659 Nonsense 269 402 3 5
Genomic Location:
Chromosome 17 (position 35536260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGACAACGCTTTGACTCAGAACCACCCCTCATCCGCAGGGCCTTTTA[C/A]GCTCTGGGGAACTACATCACTGCAACCCACATCGCAAAGGAGTCCTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045967 Nonsense 398 414 5 5
ENSDART00000137659 Nonsense 394 402 5 5
Genomic Location:
Chromosome 17 (position 35542550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAATCCAGAATCCATCCTGTATCACTGTGGATGCGAGTCCCTCTCCA[C/T]AAGAAGTGCTGAAACAAGTGCATCATTTAATTARGAACAARTGCCACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1h4j6zls