mc5ra

Ensembl ID:
ENSDARG00000031348
ZFIN ID:
ZDB-GENE-021223-3
Description:
melanocortin receptor 5 [Source:RefSeq peptide;Acc:NP_775386]
Human Orthologue:
MC5R
Human Description:
melanocortin 5 receptor [Source:HGNC Symbol;Acc:6933]
Mouse Orthologue:
Mc5r
Mouse Description:
melanocortin 5 receptor Gene [Source:MGI Symbol;Acc:MGI:99420]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23482 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040073 Nonsense 244 316 1 1
ENSDART00000139909 Nonsense 256 328 1 1
Genomic Location:
Chromosome 19 (position 13424883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCAGCCGTCACCCTGACTATCCTTCTGGGAATCTTCATCGTCTGCT[G/A]GGCTCCCTTTTTCCTCCATCTCATCCTCATGATTTCCTGTCCCAGAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u1h9h04d