rbm17

Ensembl ID:
ENSDARG00000031346
ZFIN ID:
ZDB-GENE-040426-817
Description:
splicing factor 45 [Source:RefSeq peptide;Acc:NP_957209]
Human Orthologue:
RBM17
Human Description:
RNA binding motif protein 17 [Source:HGNC Symbol;Acc:16944]
Mouse Orthologue:
Rbm17
Mouse Description:
RNA binding motif protein 17 Gene [Source:MGI Symbol;Acc:MGI:1924188]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13036 Nonsense Available for shipment Available now
sa15227 Essential Splice Site, Splice Site Available for shipment Available now
sa17424 Nonsense Available for shipment Available now
sa16442 Nonsense Available for shipment Available now
sa18785 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044043 Nonsense 4 418 2 13
ENSDART00000110388 Nonsense 4 186 2 11
ENSDART00000137622 Nonsense 4 186 2 6
ENSDART00000142276 Nonsense 4 176 2 5
Genomic Location:
Chromosome 4 (position 24602276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATGATTTTCAGTGTTTYTAGTGGAAAGGAGGARAAATGTCTTTATA[T/A]GATGATTTGGGGGTCGCAACGAGCGACGCAAAAACAGAAGGATGGTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044043 Splice Site None 418 None 13
ENSDART00000110388 Splice Site None 186 None 11
ENSDART00000137622 Essential Splice Site 160 186 6 6
ENSDART00000142276 None None 176 None 5
Genomic Location:
Chromosome 4 (position 24593576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCGCAAAGTGCARACAATCTCAACATTATGATTGTCATTGTTTGTTT[T/A]TCAGTGGAACAGTRGCTCATAAAATYATGCAGAAGTATGGTTTTCGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044043 None 239 418 8 13
ENSDART00000110388 Nonsense 164 186 6 11
ENSDART00000137622 Nonsense 164 186 6 6
ENSDART00000142276 None None 176 None 5
Genomic Location:
Chromosome 4 (position 24593562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARACAATCTCAACATTATGATTGTCATTGTTTGTTTWTCAGTGGAACAGT[G/A]GCTCATAAAATYATGCAGAAGTATGGTTTTCGGGAAGGACAGGGCCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044043 Nonsense 350 418 11 13
ENSDART00000110388 None None 186 9 11
ENSDART00000137622 None None 186 None 6
ENSDART00000142276 None None 176 None 5
ENSDART00000044043 Nonsense 350 418 11 13
ENSDART00000110388 None None 186 9 11
ENSDART00000137622 None None 186 None 6
ENSDART00000142276 None None 176 None 5
Genomic Location:
Chromosome 4 (position 24589357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGGATGAAGACCTGGAAGCTGAGACGAAAGAAGAGTGTGAAAAATA[T/A]GGCAAAGTCGTTCGATGTGTCATTTTTGAGGTAAYGTCAAACATTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044043 Nonsense 350 418 11 13
ENSDART00000110388 None None 186 9 11
ENSDART00000137622 None None 186 None 6
ENSDART00000142276 None None 176 None 5
ENSDART00000044043 Nonsense 350 418 11 13
ENSDART00000110388 None None 186 9 11
ENSDART00000137622 None None 186 None 6
ENSDART00000142276 None None 176 None 5
Genomic Location:
Chromosome 4 (position 24589357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGATGAAGACCTGGAAGCTGAGACGAAAGAAGAGTGTGAAAAATA[T/A]GGCAAAGTCGTTCGATGTGTCATTTTTGAGGTAATGTCAAACATTTTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Variant of TYR and autoimmunity susceptibility loci in generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j6ghbjm1