rab6bb

Ensembl ID:
ENSDARG00000031343
ZFIN ID:
ZDB-GENE-050320-28
Description:
RAB6B, member RAS oncogene family [Source:RefSeq peptide;Acc:NP_001013485]
Human Orthologue:
RAB6B
Human Description:
RAB6B, member RAS oncogene family [Source:HGNC Symbol;Acc:14902]
Mouse Orthologue:
Rab6b
Mouse Description:
RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8400 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25107 Nonsense Mutation detected in F1 DNA During 2016
sa10297 Essential Splice Site Available for shipment Available now
sa19736 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042255 Essential Splice Site 24 208 2 8

The following transcripts of ENSDARG00000031343 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22255777)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23142482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTCACTTCAGTGCATGTGATTTCCTGTTTTGTGTTGGTTTATTTTACA[G/A]TTGGGAAGACATCGCTGATAACAAGGTTCATGTATGACAGTTTTGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042255 Nonsense 42 208 2 8

The following transcripts of ENSDARG00000031343 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22255833)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23142538
KASP Assay ID:
554-7478.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACATCGCTGATAACAAGGTTCATGTATGACAGTTTTGACAACACTTA[T/A]CAGGTATAATATTGTATTTCAGTGCAGACGCTATATAGTTTTTCAGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042255 Essential Splice Site 43 208 2 8

The following transcripts of ENSDARG00000031343 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22255837)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23142542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCGCTGATAACAAGGTTCATGTATGACAGTTTTGACAACACTTATCAG[G/T]TATAATATTGTATTTCAGTGMAGACGCTATATAGTTTTTCAGMTATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042255 Essential Splice Site 44 208 None 8

The following transcripts of ENSDARG00000031343 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22255928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23142633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTATGATTGTTCATGTTTTAATCTTACTATCAATCGCTTTACCATCAC[A/G]GGCAACTATTGGCATTGACTTTTTATCAAAAACCATGTATCTGGAGGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link