si:ch211-284e13.2

Ensembl ID:
ENSDARG00000031336
ZFIN ID:
ZDB-GENE-030804-21
Description:
Novel protein (Sb:cb620) [Source:UniProtKB/TrEMBL;Acc:A2BFP6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11581 Essential Splice Site Available for shipment Available now
hu7900 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100769 Essential Splice Site 98 329 3 11
Genomic Location (Zv9):
Chromosome 5 (position 39806955)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37606345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGATCAGTCGCTCAGAGGAAAAACTTYACAGAGTCKCCAAAGAAATAG[G/A]TAAGTCATCCTGYGAATGAAAGAAAAACATTTACAGATCTTCTTCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100769 Nonsense 327 329 11 11
Genomic Location (Zv9):
Chromosome 5 (position 39813385)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37612775
KASP Assay ID:
554-2424.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGTCGCATYGAACCACAATTGAATGAGTTGATGGCGGAGAACAAAACC[A/T]AACAGGAATGACAYGAACGCATGGATAGAAAATGCACAAGCATCCACKWA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link