tmed1a

Ensembl ID:
ENSDARG00000031325
ZFIN ID:
ZDB-GENE-040801-229
Description:
transmembrane emp24 protein transport domain containing 1a [Source:RefSeq peptide;Acc:NP_001003487]
Human Orthologue:
TMED1
Human Description:
transmembrane emp24 protein transport domain containing 1 [Source:HGNC Symbol;Acc:17291]
Mouse Orthologue:
Tmed1
Mouse Description:
transmembrane emp24 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:106201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047071 Nonsense 26 226 1 4
Genomic Location (Zv9):
Chromosome 3 (position 48423624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50424764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTCTATCCTTCCTGACGCTCTGTCTGGATTTGGGATTCACTTTCGGA[C/T]AGAATAAAGACACCGAGTTCACCTTCCTTCTGCCTGCTGGAGCAACCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link