ppdpfb

Ensembl ID:
ENSDARG00000031317
ZFIN ID:
ZDB-GENE-030131-8247
Description:
Pancreatic progenitor cell differentiation and proliferation factor B [Source:UniProtKB/Swiss-Prot;A
Human Orthologue:
PPDPF
Human Description:
pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) [Source:HGNC
Mouse Orthologue:
Ppdpf
Mouse Description:
pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)RIKEN cDNA 27

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17398 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043076 Essential Splice Site 78 115 None 5

The following transcripts of ENSDARG00000031317 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17599085)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17502024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNGAACCTGCCTGGTATGGGAACTGTTGCAGAGGAGGCTCAGCAGAAG[T/C]GAGTCACTGGATTGAGTTTCAGCCAGTTTTGGTTGCATGTAACATGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link