ENSDARG00000031278

Ensembl ID:
ENSDARG00000031278
Human Orthologue:
ASB8
Human Description:
ankyrin repeat and SOCS box-containing 8 [Source:HGNC Symbol;Acc:17183]
Mouse Orthologue:
Asb8
Mouse Description:
ankyrin repeat and SOCS box-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1925791]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4484 Nonsense F2 line generated During 2016
sa35404 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042875 Essential Splice Site 82 609 3 14
Genomic Location (Zv9):
Chromosome 13 (position 3032181)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3209600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCACTAGATCGGCATATACCCTATATTATGATCTTCTTTCATTGTTC[T/A]GACAGCTGATATTGAAGCTCGCACATACAAAGACAAGCAGACTCCACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4484
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042875 Nonsense 238 609 6 14
Genomic Location (Zv9):
Chromosome 13 (position 3028935)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3206354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCGTCAATCTGGGCAAACTGGATCTCATCATGCACCCTGTAGYGCTC[A/T]AACTCATCACTGTCAAGTGGAACCTGTATGGCAGGTAAACCGAGATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042875 Essential Splice Site 287 609 8 14
Genomic Location (Zv9):
Chromosome 13 (position 3026546)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3203965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTACGAGGTGGTCGTAATGTTTTGGCTAATTTTTGCATTTCTTTTGGC[A/T]GGACTGGTGGCGTGTGCTGCTGGTTGTTTTGGCACTTGTGTTGACAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link