ENSDARG00000031278

Ensembl ID:
ENSDARG00000031278
Human Orthologue:
ASB8
Human Description:
ankyrin repeat and SOCS box-containing 8 [Source:HGNC Symbol;Acc:17183]
Mouse Orthologue:
Asb8
Mouse Description:
ankyrin repeat and SOCS box-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1925791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4484 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4484
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042875 Nonsense 238 609 6 14
Genomic Location:
Chromosome 13 (position 3028935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCGTCAATCTGGGCAAACTGGATCTCATCATGCACCCTGTAGYGCTC[A/T]AACTCATCACTGTCAAGTGGAACCTGTATGGCAGGTAAACCGAGATTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0981k2gc