si:ch211-208m13.2

Ensembl ID:
ENSDARG00000031269
ZFIN ID:
ZDB-GENE-050208-529
Description:
Novel protein similar to vertebrate ring finger protein 123 (RNF123) [Source:UniProtKB/TrEMBL;Acc:A5
Human Orthologue:
RNF123
Human Description:
ring finger protein 123 [Source:HGNC Symbol;Acc:21148]
Mouse Orthologue:
Rnf123
Mouse Description:
ring finger protein 123 Gene [Source:MGI Symbol;Acc:MGI:2148796]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39382 Nonsense Mutation detected in F1 DNA During 2017
sa39381 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044429 Nonsense 316 789 9 22
ENSDART00000148147 Nonsense 209 681 5 18
Genomic Location (Zv9):
Chromosome 22 (position 37385244)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34554744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGAACCACCTGAGTCGTAGGTTGGCCTGGATCAACGCCACCATCTA[C/A]TCCAAGGTATCGCTGACACTCTGGCCAGAAAAACACTGGGAAACAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044429 Essential Splice Site 536 789 15 22
ENSDART00000148147 Essential Splice Site 428 681 11 18
Genomic Location (Zv9):
Chromosome 22 (position 37359950)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34529450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCAGCTCAACTGGGCCTTCTCTGAATTCATCGGCATGATACAGGAGG[T/C]AAGAAGCTTTCGAATCTTTCAACGTGTTAGACAAATAGCCTCACCTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link