enkur

Ensembl ID:
ENSDARG00000031248
ZFIN ID:
ZDB-GENE-070718-1
Description:
C10orf63 protein [Source:UniProtKB/TrEMBL;Acc:Q7ZWE8]
Human Orthologue:
ENKUR
Human Description:
enkurin, TRPC channel interacting protein [Source:HGNC Symbol;Acc:28388]
Mouse Orthologue:
Enkur
Mouse Description:
enkurin, TRPC channel interacting protein Gene [Source:MGI Symbol;Acc:MGI:1918483]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4283 Nonsense Mutation detected in F1 DNA During 2014
sa14631 Nonsense Available for shipment Available now
sa25208 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042478 Nonsense 103 299 2 5
Genomic Location:
Chromosome 24 (position 6806849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKAAATCTATGGGACCAGCWAAAGTGGACGTCCCATTGCCACAGAAATA[T/A]CTACTAAAACACTCGAAGGAACCCAAACTCCCTGAAAGTATGTGAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042478 Nonsense 121 299 3 5
Genomic Location:
Chromosome 24 (position 6806379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTGTCTGATCATTWATTTYTGCTGTTTCAGAGAAACCATTTAAATA[T/A]GAAGATGATGAGCTGCATTATAAACCACCAGTACCTGCTAGAACTGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042478 Essential Splice Site 193 299 3 5
Genomic Location:
Chromosome 24 (position 6806162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACCGCTTGAAAACTCTGGTCTCGTTCCTAAATATATAAAGAAGAAG[G/A]TGAGGAGAGGGATTTAATCAGTTTCCTGCTTTTGTATTCATGCAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042478 Nonsense 216 299 4 5
Genomic Location:
Chromosome 24 (position 6804386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAKATYTGCTTCAGCGCAGAGAGGAAGTCAGGAAAGCACAAGAGGAATW[T/A]GACAGCTACGTCAAAGAGCRGATGAAAGAAGGGGCCATGAAACAGCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0eqgvqcy