hbegfb

Ensembl ID:
ENSDARG00000031246
ZFIN ID:
ZDB-GENE-070820-6
Description:
heparin-binding EGF-like growth factor b [Source:RefSeq peptide;Acc:NP_001093871]
Human Orthologue:
HBEGF
Human Description:
heparin-binding EGF-like growth factor [Source:HGNC Symbol;Acc:3059]
Mouse Orthologue:
Hbegf
Mouse Description:
heparin-binding EGF-like growth factor Gene [Source:MGI Symbol;Acc:MGI:96070]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37340 Nonsense Mutation detected in F1 DNA During 2016
sa11891 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010193 Nonsense 108 239 3 6
ENSDART00000130676   None 113 None 4
ENSDART00000130820 Nonsense 132 263 3 6
Genomic Location:
Chromosome 21 (position 28910241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCACTGACATCACTCTTGCTCAACAGTGGCATTTTCCACCAAACCC[A/T]AACATCCGTCGGCGATGCCCACTACTGAGAAGACAAAAAAAAGAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010193 Nonsense 138 239 3 6
ENSDART00000130676 Nonsense 4 113 1 4
ENSDART00000130820 Nonsense 162 263 3 6
Genomic Location:
Chromosome 21 (position 28910149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAAGGAAGGRCAAAGGAAAAGGCAGGGGGAATAAGAAGAACCTCTG[C/A]RAGGAGGAATACAAAGATTTCTGCATTCATGGAGTGTGTCAKTATCWGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link