kidins220a

Ensembl ID:
ENSDARG00000031240
ZFIN ID:
ZDB-GENE-041014-170
Description:
Novel protein similar to rat kinase D-interacting substance of 220 kDa (RGD:619949) [Source:UniProtK
Human Orthologue:
KIDINS220
Human Description:
kinase D-interacting substrate, 220kDa [Source:HGNC Symbol;Acc:29508]
Mouse Orthologue:
Kidins220
Mouse Description:
kinase D-interacting substrate 220 Gene [Source:MGI Symbol;Acc:MGI:1924730]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23131 Nonsense Mutation detected in F1 DNA During 2016
sa8802 Nonsense Mutation detected in F1 DNA During 2016
sa19182 Nonsense Mutation detected in F1 DNA During 2016
sa11853 Nonsense Available for shipment Available now
sa42974 Nonsense Mutation detected in F1 DNA During 2016
sa23130 Nonsense Available for shipment Available now
sa42973 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 113 1694 4 29
ENSDART00000145664 Nonsense 113 1009 4 21
Genomic Location (Zv9):
Chromosome 17 (position 35110950)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34995874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACGTGGTAATATAATGACCTTGGTATGTTTGTGTTAAGGGGGGCTG[G/A]AGTGCGCTCATGTGGGCCGCTTATAAGGGCCGTGTGGAGGTGGCAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 393 1694 11 29
ENSDART00000145664 Nonsense 393 1009 11 21
ENSDART00000021128 Nonsense 393 1694 11 29
ENSDART00000145664 Nonsense 393 1009 11 21
Genomic Location (Zv9):
Chromosome 17 (position 35102458)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34987382
KASP Assay ID:
2261-1324.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACACACCTCTGCATATTGCCATCCGTGGGAGAAGCCGCAAACTGGCT[G/T]AGCTGCTCTTGAGAAAYCCTAAAGATGGCCGTCTGCTCTACMGGCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 393 1694 11 29
ENSDART00000145664 Nonsense 393 1009 11 21
ENSDART00000021128 Nonsense 393 1694 11 29
ENSDART00000145664 Nonsense 393 1009 11 21
Genomic Location (Zv9):
Chromosome 17 (position 35102458)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34987382
KASP Assay ID:
2261-1324.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACACACCTCTGCATATTGCCATCCGTGGGAGAAGCCGCAAACTGGCT[G/T]AGCTGCTCTTGAGAAACCCTAAAGATGGCCGTCTGCTCTACCGGCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 396 1694 11 29
ENSDART00000145664 Nonsense 396 1009 11 21
Genomic Location (Zv9):
Chromosome 17 (position 35102448)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34987372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCATATTGCCATCCGTGGGAGAAGCCGCAAACTGGCTKAGCTGCTCT[T/A]GAGAAAYCCTAAAGATGGCCGTCTGCTCTACMGGCCCAACAAAGAGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 459 1694 12 29
ENSDART00000145664 Nonsense 459 1009 12 21
Genomic Location (Zv9):
Chromosome 17 (position 35098069)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34982993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGATATGCTGGGTTATGACCTGTACAGCAGTGCTCTGGCTGATATCT[T/A]GAGTGAACCCACAATGCAGCCTCCCATCTGTGTGGGCCTTTATGCCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 842 1694 18 29
ENSDART00000145664 Nonsense 842 1009 18 21
Genomic Location (Zv9):
Chromosome 17 (position 35080216)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34965140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAACAGTGTGCTGCGCGACTCCAACATCAACGGCCATGACTACATG[C/T]GAAACATCATCCACCTGCCCGTGTTCCTCAACAGCCGTGGCCTCAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021128 Nonsense 1486 1694 29 29
ENSDART00000145664   None 1009 None 21
Genomic Location (Zv9):
Chromosome 17 (position 34982054)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 34866978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACTAAAAACCCACCCAGACGCAAAACCAAAGGACAGGGCCCTTATTA[T/G]CACAGTTTACCGAGTGACGAAGACGACTCTGGAGATGAGGAAACTGATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link