lhx2b

Ensembl ID:
ENSDARG00000031222
ZFIN ID:
ZDB-GENE-051220-1
Description:
LIM/homeobox protein Lhx2 [Source:RefSeq peptide;Acc:NP_001035099]
Human Orthologue:
LHX2
Human Description:
LIM homeobox 2 [Source:HGNC Symbol;Acc:6594]
Mouse Orthologue:
Lhx2
Mouse Description:
LIM homeobox protein 2 Gene [Source:MGI Symbol;Acc:MGI:96785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6091 Nonsense Mutation detected in F1 DNA During 2014
sa21179 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033846 Nonsense 72 396 2 5
ENSDART00000136250 Nonsense 31 134 2 3
ENSDART00000148020 Nonsense 103 427 2 5
Genomic Location:
Chromosome 8 (position 3254261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGGAGGCAAGATTTCGGATCGCTACTACCTGCTCGCCGTGGACAAG[C/T]AATGGCACATGCGCTGTYTGAAGTGCTGCGAGTGTAAACTGAACCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033846 Nonsense 84 396 2 5
ENSDART00000136250 Nonsense 43 134 2 3
ENSDART00000148020 Nonsense 115 427 2 5
Genomic Location:
Chromosome 8 (position 3254297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCGTGGACAAGCAATGGCACATGCGCTGTCTGAAGTGCTGCGAGTGT[A/T]AACTGAACCTGGAGTCTGAGCTCACCTGCTTCAGCAAAGACGGAAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8z4s7lmz