si:dkey-1h24.5

Ensembl ID:
ENSDARG00000031202
ZFIN ID:
ZDB-GENE-030131-7282
Description:
Asparagine-linked glycosylation protein 11 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW24]
Human Orthologues:
AL139082.3, ALG11
Human Descriptions:
asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) [Source:HGNC Symbo
Asparagine-linked glycosylation protein 11 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q2TAA5]
Mouse Orthologue:
Alg11
Mouse Description:
asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2-mannosyltransferase) Gene [Source:MGI S

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12399 Nonsense Available for shipment Available now
sa24848 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049514 Nonsense 111 500 3 5
ENSDART00000136760 Nonsense 90 195 3 4
ENSDART00000140345 Nonsense 82 265 3 4
Genomic Location (Zv9):
Chromosome 1 (position 28702480)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28953309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTCGTAGTCTACACGGGTGATCAGGGGGTGACGGCAGAAGAGATTT[T/A]GGATGGAGCACGGAGAYGMTTTAACATCAGACTCCCCCGAYCCGTTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049514 Nonsense 364 500 4 5
ENSDART00000136760   None 195 None 4
ENSDART00000140345   None 265 None 4
Genomic Location (Zv9):
Chromosome 1 (position 28699820)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28950649
KASP Assay ID:
554-7820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTCGGAACCAGGAGGATGAAGATCGGGTTCTGATGCTGAGAGGAT[T/A]GTGCCAGGAGCTGGGCATAGCAGACAGGGTGGAGTTTAAGCTCAATATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link