ppp2r5c

Ensembl ID:
ENSDARG00000031200
ZFIN ID:
ZDB-GENE-041014-4
Description:
serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform [Source:RefSeq pept
Human Orthologue:
PPP2R5C
Human Description:
protein phosphatase 2, regulatory subunit B', gamma [Source:HGNC Symbol;Acc:9311]
Mouse Orthologue:
Ppp2r5c
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), gamma isoform Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3085 Essential Splice Site F2 line generated During 2017
sa17560 Essential Splice Site, Missense Available for shipment Available now
sa29479 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3085
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020266   30 578 3 19
ENSDART00000052781   None 420 None 12
ENSDART00000109320   30 578 3 18
ENSDART00000110252 Essential Splice Site 30 577 3 17
Genomic Location (Zv9):
Chromosome 20 (position 54313398)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54168801
KASP Assay ID:
554-3272.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGAGAGGTGATGTTAAAGTRTGAARTGTCCTTTGTTTTTCGTCAGCA[G/A]GCTTCGAATAAGAAGGGTGGGAACAGCGTCCCGCCGGCCACACAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020266 Essential Splice Site 471 578 None 19
ENSDART00000052781 Missense 419 420 11 12
ENSDART00000109320 Essential Splice Site 471 578 None 18
ENSDART00000110252 Essential Splice Site 470 577 None 17
Genomic Location (Zv9):
Chromosome 20 (position 54261525)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54116928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCTGTTTGAKGACTGCACACAGCAGTTCAGAGCCGAGAAAAACAAG[T/C]AGGAAGAGCTTTCAGTAACTCTCACACACTGTCACGAGCTCWCTTCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020266   None 578 16 19
ENSDART00000052781   None 420 None 12
ENSDART00000109320   None 578 16 18
ENSDART00000110252 Essential Splice Site None 577 16 17
Genomic Location (Zv9):
Chromosome 20 (position 54259036)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54114439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGAGGACACAAGCACATGCACACACAAATACACACACACACACACACA[T/A]CTCAAACCAAACCCGGTGTTCTGACGATATGTGCTAAACCCTCAGAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Autism: A genome-wide scan for common alleles affecting risk for autism. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link