irx3b

Ensembl ID:
ENSDARG00000031138
ZFIN ID:
ZDB-GENE-030131-525
Description:
iroquois homeobox protein 3b [Source:RefSeq peptide;Acc:NP_998265]
Human Orthologue:
IRX3
Human Description:
iroquois homeobox 3 [Source:HGNC Symbol;Acc:14360]
Mouse Orthologue:
Irx3
Mouse Description:
Iroquois related homeobox 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1197522]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24733 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042271 Nonsense 324 343 2 2
Genomic Location (Zv9):
Chromosome 25 (position 37492117)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35905673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCTTTCAGCCCATCAGATGGCCTTCACTAGCCATTACCTCGGACTT[A/T]AACACCAGAGCATCGCAAACATACACGTGAAACACGCAGAGCAGAGGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link