moxd1

Ensembl ID:
ENSDARG00000031136
ZFIN ID:
ZDB-GENE-030131-9320
Description:
DBH-like monooxygenase protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ24]
Human Orthologue:
MOXD1
Human Description:
monooxygenase, DBH-like 1 [Source:HGNC Symbol;Acc:21063]
Mouse Orthologue:
Moxd1
Mouse Description:
monooxygenase, DBH-like 1 Gene [Source:MGI Symbol;Acc:MGI:1921582]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23701 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044032 Essential Splice Site 87 604 2 13
ENSDART00000127291 Essential Splice Site 90 609 1 12
ENSDART00000130494 Essential Splice Site 90 614 1 12
Genomic Location:
Chromosome 20 (position 25255155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGATATCGTTATAGGCGGTGTGCTCAACGGAAGCCCATATCTGCTG[G/A]TAAGCGTGCGCACACACCTTTGCCTGCCAACGCATCTCTCGTTTAATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dsr1y9s5