NP_001155126.1

Ensembl ID:
ENSDARG00000031126
Description:
protein notum homolog [Source:RefSeq peptide;Acc:NP_001155126]
Human Orthologue:
NOTUM
Human Description:
notum pectinacetylesterase homolog (Drosophila) [Source:HGNC Symbol;Acc:27106]
Mouse Orthologue:
Notum
Mouse Description:
notum pectinacetylesterase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924833]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31363 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047418 Essential Splice Site 183 500 4 11
Genomic Location (Zv9):
Chromosome 3 (position 58783580)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57899168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCACTCCCAGAGGAAAACCCACACTGGTGGAACGCCAACATGGTG[T/A]GAGTATCCCAGAGCTAATGTTTGTGAAAATACATTCTTTACATCTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link