baiap2l1b

Ensembl ID:
ENSDARG00000031119
ZFIN ID:
ZDB-GENE-050417-371
Description:
BAI1-associated protein 2-like 1b [Source:RefSeq peptide;Acc:NP_001017830]
Human Orthologue:
BAIAP2L1
Human Description:
BAI1-associated protein 2-like 1 [Source:HGNC Symbol;Acc:21649]
Mouse Orthologue:
Baiap2l1
Mouse Description:
BAI1-associated protein 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914148]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1828 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101957 Essential Splice Site 91 412 4 11
Genomic Location:
Chromosome 3 (position 62043153)
KASP Assay ID:
554-1820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGTCTGAAACACGCCGTTGAGAGTCTGTATCCTTGTCTGTTTTGCTCA[G/A]TGTCTGGAAACACTCACCCACCGTCAGATGGACATGCAGAAGTTCATCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gpwidlm8