baiap2l1b

Ensembl ID:
ENSDARG00000031119
ZFIN ID:
ZDB-GENE-050417-371
Description:
BAI1-associated protein 2-like 1b [Source:RefSeq peptide;Acc:NP_001017830]
Human Orthologue:
BAIAP2L1
Human Description:
BAI1-associated protein 2-like 1 [Source:HGNC Symbol;Acc:21649]
Mouse Orthologue:
Baiap2l1
Mouse Description:
BAI1-associated protein 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914148]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33345 Nonsense Mutation detected in F1 DNA During 2016
sa33344 Nonsense Mutation detected in F1 DNA During 2016
sa1828 Essential Splice Site Available for shipment Available now
sa40192 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101957 Nonsense 43 412 2 11
Genomic Location (Zv9):
Chromosome 3 (position 62058540)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61217065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGAGGTTATTGCGGAGTTGGAGAGGAAAACAGACATGGATGTGAAGTA[C/A]ATGACGGTGAGCTGATAAAACACACTGATCTGCTTTATAAGACGTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101957 Nonsense 49 412 3 11
Genomic Location (Zv9):
Chromosome 3 (position 62056692)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61215217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAATTGTTTTTTAAGTCTTAGATTGTGTCTGTGTGCAGGCCACGTTT[A/T]AGAGATATCAGACGGAACACAAGATGAAGCAGGACTCGCTGGAGAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101957 Essential Splice Site 91 412 4 11
Genomic Location (Zv9):
Chromosome 3 (position 62043153)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61201678
KASP Assay ID:
554-1820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGTCTGAAACACGCCGTTGAGAGTCTGTATCCTTGTCTGTTTTGCTCA[G/A]TGTCTGGAAACACTCACCCACCGTCAGATGGACATGCAGAAGTTCATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101957 Essential Splice Site 141 412 4 11
Genomic Location (Zv9):
Chromosome 3 (position 62042998)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61201523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAAACACTGCTCCTTCTCACACCAGGTCTCCGCTTTCCATCAAAAGG[T/A]GCGTTTGGTTAAGGCGCTGGGCGTGGGAAATCCCTTACAAATCCCTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link