im:7138144

Ensembl ID:
ENSDARG00000031108
ZFIN ID:
ZDB-GENE-041008-137
Description:
Novel protein similar to vertebrate LPS-responsive vesicle trafficking, beach and anchor containing
Human Orthologue:
LRBA
Human Description:
LPS-responsive vesicle trafficking, beach and anchor containing [Source:HGNC Symbol;Acc:1742]
Mouse Orthologue:
Lrba
Mouse Description:
LPS-responsive beige-like anchor Gene [Source:MGI Symbol;Acc:MGI:1933162]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa780 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 971 2861 22 56
ENSDART00000146960 Nonsense 358 1847 9 34
Genomic Location:
Chromosome 1 (position 23002535)
KASP Assay ID:
554-0685.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTGAGCTACGTGTAGAGGAGCAGGACAACGATCAGACTGCAGACAAT[G/T]AGGAGATGCAGACCCAGATCCCTGTCACAGTGTCCAACATTCTGGTCAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/91304vc5