timm50

Ensembl ID:
ENSDARG00000031098
ZFIN ID:
ZDB-GENE-040426-1618
Description:
Mitochondrial import inner membrane translocase subunit TIM50 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWD
Human Orthologue:
TIMM50
Human Description:
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:23656
Mouse Orthologue:
Timm50
Mouse Description:
translocase of inner mitochondrial membrane 50 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:19137

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22624 Nonsense Mutation detected in F1 DNA During 2014
sa12674 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048423 Nonsense 333 387 10 11
Genomic Location:
Chromosome 15 (position 19440487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGTTCAGCTATTGCCATCAGCGGGGTGGAGGATGTGCGTTCAGTAT[T/A]AGAGAACTACGCCCATGAGGAAGACCCTATTGAAGCTTTCAAAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048423 Essential Splice Site 355 387 10 11
Genomic Location:
Chromosome 15 (position 19440419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGAYCCTATTGAAGCTTTCAAAAGAAGACAGGCACAGCTTGCACAG[G/T]TATGCACTTCAGTTTCATGATTGAGTCRCAGGATTTACATTAAATGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uol95rlp