timm50

Ensembl ID:
ENSDARG00000031098
ZFIN ID:
ZDB-GENE-040426-1618
Description:
Mitochondrial import inner membrane translocase subunit TIM50 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWD
Human Orthologue:
TIMM50
Human Description:
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:23656
Mouse Orthologue:
Timm50
Mouse Description:
translocase of inner mitochondrial membrane 50 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:19137

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42531 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22624 Nonsense Mutation detected in F1 DNA During 2016
sa12674 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048423 Essential Splice Site 234 387 7 11
Genomic Location (Zv9):
Chromosome 15 (position 19454439)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20557065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGCGCCACTTTATGAGATAGTCATCTTCACATCAGAGACAGGCATGG[T/A]GAGTCTCAGGGGTGATCGGGACTGTCTGTTTTCCGCAATAATGCCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048423 Nonsense 333 387 10 11
Genomic Location (Zv9):
Chromosome 15 (position 19440487)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20543113
KASP Assay ID:
2260-8358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGTTCAGCTATTGCCATCAGCGGGGTGGAGGATGTGCGTTCAGTAT[T/A]AGAGAACTACGCCCATGAGGAAGACCCTATTGAAGCTTTCAAAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048423 Essential Splice Site 355 387 10 11
Genomic Location (Zv9):
Chromosome 15 (position 19440419)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20543045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGAYCCTATTGAAGCTTTCAAAAGAAGACAGGCACAGCTTGCACAG[G/T]TATGCACTTCAGTTTCATGATTGAGTCRCAGGATTTACATTAAATGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link