cadm1a

Ensembl ID:
ENSDARG00000031075
ZFIN ID:
ZDB-GENE-080505-2
Description:
cell adhesion molecule 1a [Source:RefSeq peptide;Acc:NP_001107023]
Human Orthologue:
CADM1
Human Description:
cell adhesion molecule 1 [Source:HGNC Symbol;Acc:5951]
Mouse Orthologue:
Cadm1
Mouse Description:
cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1889272]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23937 Nonsense Available for shipment Available now
sa37308 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065599 Nonsense 78 408 3 10
ENSDART00000111169 Nonsense 58 427 4 13
ENSDART00000112869 Nonsense 78 436 3 11
ENSDART00000145541 Nonsense 78 447 3 12
Genomic Location (Zv9):
Chromosome 21 (position 23565244)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24250918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCAAAAACAATGACGACTCCGTCATCCAGCTCCTTAACCCCAACAGA[C/T]AGACCATCTACTTCAAAGACGTCAGACGTGAGTATACATTCTCATACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065599 Nonsense 231 408 6 10
ENSDART00000111169 Nonsense 211 427 7 13
ENSDART00000112869 Nonsense 231 436 6 11
ENSDART00000145541 Nonsense 231 447 6 12
Genomic Location (Zv9):
Chromosome 21 (position 23602635)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24288309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGTCTGCATTGTTGACCATCCAGCAGTCAAGGACTTTCAGGCACAG[A/T]AGTACCTCGAAGTGCAATGTGAGTGAGATTTTAGTGTTTTAGTCATTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link