gpatch2

Ensembl ID:
ENSDARG00000031064
ZFIN ID:
ZDB-GENE-041014-260
Description:
Novel protein similar to vertebrate glutamic pyruvate transaminase (Alanine aminotransferase) 2 (GPT
Human Orthologue:
GPATCH2
Human Description:
G patch domain containing 2 [Source:HGNC Symbol;Acc:25499]
Mouse Orthologue:
Gpatch2
Mouse Description:
G patch domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915019]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43529 Missense, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100331 Splice Site None 478 None 12
ENSDART00000138288 Missense 351 408 5 6
Genomic Location (Zv9):
Chromosome 20 (position 47094390)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46939673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAAAAAGACGACGGAAAGCTGCGCCTGTAGGAGCACAATCATCTTCAG[G/A]TAACTGTGGGGTCTTAAAAAGTCTTGAAATGTTTTAAATTCCAAATACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link