il4r

Ensembl ID:
ENSDARG00000031051
ZFIN ID:
ZDB-GENE-050227-5
Description:
interleukin 4 receptor [Source:RefSeq peptide;Acc:NP_001013300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20105 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049396 Essential Splice Site None 220 None 7
ENSDART00000110812 Essential Splice Site None 571 None 10
ENSDART00000111201 Essential Splice Site 50 624 None 10
Genomic Location (Zv9):
Chromosome 3 (position 42550231)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43358774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGTGTGAATTTTATTTCTGTATAATTTATTCTGTGTGTTTTTATGC[A/T]GGATATAGGATGTCTTCCTCATTATTTCTTTACCAGATCATCCTCACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link