igsf21a

Ensembl ID:
ENSDARG00000031049
ZFIN ID:
ZDB-GENE-050809-118
Description:
immunoglobin superfamily, member 21a [Source:RefSeq peptide;Acc:NP_001029356]
Human Orthologue:
IGSF21
Human Description:
immunoglobin superfamily, member 21 [Source:HGNC Symbol;Acc:28246]
Mouse Orthologue:
Igsf21
Mouse Description:
immunoglobin superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2681842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13436 Nonsense Available for shipment Available now
sa21932 Essential Splice Site Mutation detected in F1 DNA During 2015
sa30948 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041443   None 375 None 7
ENSDART00000123245 Nonsense 37 494 1 10
ENSDART00000140871 Nonsense 37 84 1 2
Genomic Location:
Chromosome 11 (position 29958720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTGCAAAATATGGGAAAGATGACCGTYTTGTCTTTGTGTTTTCTCT[T/A]GTGCGCTGATCTACTGCAAGTAGCTGTTGGTAAGTAATTCTTATGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041443   None 375 None 7
ENSDART00000123245 Essential Splice Site 84 494 None 10
ENSDART00000140871   84 84 None 2
Genomic Location:
Chromosome 11 (position 29787891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACTTCAAGACAGATGGAAGATTACGAGAGATCGTATGGTACAGGG[T/A]AAGTTGCAGTTTACTCTTAATTTATCATCATTGTTTAAGTTCATAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041443   None 375 None 7
ENSDART00000123245 Essential Splice Site 125 494 3 10
ENSDART00000140871   None 84 None 2
Genomic Location:
Chromosome 11 (position 29685724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGGATTACCGCAGACGGGAAGACCTGGTGTATCAGTCGACGGTCCG[G/T]TAAGAACCTTTCAGTGTTATTTGATTGCTACTGGATGTAATATTTATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fpcdr9h5