igsf21a

Ensembl ID:
ENSDARG00000031049
ZFIN ID:
ZDB-GENE-050809-118
Description:
immunoglobin superfamily, member 21a [Source:RefSeq peptide;Acc:NP_001029356]
Human Orthologue:
IGSF21
Human Description:
immunoglobin superfamily, member 21 [Source:HGNC Symbol;Acc:28246]
Mouse Orthologue:
Igsf21
Mouse Description:
immunoglobin superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2681842]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13436 Nonsense Available for shipment Available now
sa21932 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041443 None None 375 None 7
ENSDART00000123245 Nonsense 37 494 1 10
ENSDART00000140871 Nonsense 37 84 1 2
Genomic Location:
Chromosome 11 (position 29958720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTGCAAAATATGGGAAAGATGACCGTYTTGTCTTTGTGTTTTCTCT[T/A]GTGCGCTGATCTACTGCAAGTAGCTGTTGGTAAGTAATTCTTATGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041443 None None 375 None 7
ENSDART00000123245 Essential Splice Site 84 494 None 10
ENSDART00000140871 None 84 84 None 2
Genomic Location:
Chromosome 11 (position 29787891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACTTCAAGACAGATGGAAGATTACGAGAGATCGTATGGTACAGGG[T/A]AAGTTGCAGTTTACTCTTAATTTATCATCATTGTTTAAGTTCATAATTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fpcdr9h5