ptrh1

Ensembl ID:
ENSDARG00000031047
ZFIN ID:
ZDB-GENE-050306-33
Description:
hypothetical protein LOC559192 [Source:RefSeq peptide;Acc:NP_001119866]
Human Orthologue:
PTRH1
Human Description:
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:27039]
Mouse Orthologue:
Ptrh1
Mouse Description:
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913779]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2189 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2189
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050196 Essential Splice Site None 230 1 6
ENSDART00000136850   None 154 1 3
ENSDART00000142927 Essential Splice Site None 266 1 6
Genomic Location (Zv9):
Chromosome 5 (position 67596307)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64397948
KASP Assay ID:
554-2433.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAATGTGTGGGTCCATTTGACTGATATTAGTGAATGAATCGCAAATG[T/A]AAGGTCTTTAAATTGGACTTMAGACAATACCGATTACTCTTTTTATATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link