nr1h5

Ensembl ID:
ENSDARG00000031046
ZFIN ID:
ZDB-GENE-080403-3
Description:
nuclear receptor subfamily 1, group H, member 5 [Source:RefSeq peptide;Acc:NP_001116713]
Mouse Orthologue:
Nr1h5
Mouse Description:
nuclear receptor subfamily 1, group H, member 5 Gene [Source:MGI Symbol;Acc:MGI:3026618]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15588 Nonsense Available for shipment Available now
sa21210 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa15588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064040 Nonsense 113 490 2 10
ENSDART00000124313 Nonsense 113 486 3 11

The following transcripts of ENSDARG00000031046 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11790564)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10878560
KASP Assay ID:
2260-0212.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCCAAAGCTCAACAGCCAGAGCCAGCATTGTTGGTCTTCCAGTGCTG[A/T]AAAGACCCAGAATGGGCYATGGAGCTCGAGTGAAGGGCCAGGATGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064040 Missense 386 490 9 10
ENSDART00000124313 Essential Splice Site 378 486 10 11

The following transcripts of ENSDARG00000031046 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11800703)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10868421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGACTTAATGTTTTGTTGTCTTTGCTTGTGCTTTATATCTTTGTTCA[G/A]GGTTGAATGATGAGCTCTTGAGATCTGTGGTAAATTTCCTTCATAGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link