lipg

Ensembl ID:
ENSDARG00000031044
ZFIN ID:
ZDB-GENE-040426-699
Description:
endothelial lipase [Source:RefSeq peptide;Acc:NP_956422]
Human Orthologue:
LIPG
Human Description:
lipase, endothelial [Source:HGNC Symbol;Acc:6623]
Mouse Orthologue:
Lipg
Mouse Description:
lipase, endothelial Gene [Source:MGI Symbol;Acc:MGI:1341803]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21337 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098850 Nonsense 231 500 5 10
ENSDART00000143716 Nonsense 208 245 5 5

The following transcripts of ENSDARG00000031044 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 33229287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGATGCAGATTTTGTCGACGTCCTGCACACATACACACGTGGAGCTT[T/A]GGGTGTCAGTATTGGGATCCAGGAGCCAATTGGCCACATTGACATCTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HDL cholesterol: Genome-wide association analysis of high-density lipoprotein cholesterol in the population-based KORA study sheds new light on intergenic regions. (View Study)
  • Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lhh62y2f