pip5k2

Ensembl ID:
ENSDARG00000031020
ZFIN ID:
ZDB-GENE-030828-9
Description:
Phosphatidylinositol-5-phosphate 4-kinase type-2 gamma [Source:UniProtKB/Swiss-Prot;Acc:Q6IQE1]
Human Orthologue:
PIP4K2C
Human Description:
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma [Source:HGNC Symbol;Acc:23786]
Mouse Orthologue:
Pip4k2c
Mouse Description:
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma Gene [Source:MGI Symbol;Acc:MGI:2152214]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44034 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042701 Essential Splice Site 87 417 2 11
Genomic Location (Zv9):
Chromosome 23 (position 36665677)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36497154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCAAAGCCAACACCAAAATTAAAGTGAACAACCACCTCTTCAACAAG[T/G]ATTTATCAAAAGCTCATCATTTTTTTACACACATTTTCCTCAAAAAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042701 Nonsense 110 417 3 11
Genomic Location (Zv9):
Chromosome 23 (position 36672261)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36503738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTAAGTTCAAGGAGTATTGTCCACAAGTTTTCAGAAACCTCAGGGAG[C/T]GATTTGGAATTGAAGATCTTGAYTACCAGGTGACTTTTGTTTAKWATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link