LOC571639

Ensembl ID:
ENSDARG00000031013
Human Orthologue:
C1QL1
Human Description:
complement component 1, q subcomponent-like 1 [Source:HGNC Symbol;Acc:24182]
Mouse Orthologue:
C1ql1
Mouse Description:
complement component 1, q subcomponent-like 1 Gene [Source:MGI Symbol;Acc:MGI:1344400]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19347 Nonsense Mutation detected in F1 DNA During 2014
sa8045 Nonsense Mutation detected in F1 DNA During 2014
sa10634 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042410 Nonsense 166 278 1 3
ENSDART00000042410 Nonsense 166 278 1 3
Genomic Location:
Chromosome 24 (position 38247260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCCTTCTATGCAGGTCTTCGAAACCCACAGGAGGGCTATGAGATCT[T/A]GAGGTTTGACGATGTGGTTACAAACATTGGGAATAACTATGATGGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042410 Nonsense 166 278 1 3
ENSDART00000042410 Nonsense 166 278 1 3
Genomic Location:
Chromosome 24 (position 38247260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCCTTCTATGCAGGTCTTCGAAACCCACAGGAGGGCTAYGAGATCT[T/A]GAGGTTTGAYGATGTGGTTACAAACATTGGGAATAACTATGATGGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042410 Nonsense 194 278 1 3
Genomic Location:
Chromosome 24 (position 38247345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTATGATGGAGCAACTGGGAAATTTGTGTGCAAAGTTCCTGGGACGTA[T/A]TTCTTCACATATAATGTCCTCATGAGAGGAGGGGATGGAACCAGTATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/imeh4r88