LOC569128

Ensembl ID:
ENSDARG00000030975
Human Orthologue:
CCDC80
Human Description:
coiled-coil domain containing 80 [Source:HGNC Symbol;Acc:30649]
Mouse Orthologue:
Ccdc80
Mouse Description:
coiled-coil domain containing 80 Gene [Source:MGI Symbol;Acc:MGI:1915146]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33833 Nonsense Mutation detected in F1 DNA During 2017
sa33834 Nonsense Mutation detected in F1 DNA During 2017
sa38545 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040035 Nonsense 7 852 1 7
Genomic Location (Zv9):
Chromosome 6 (position 16325008)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16280266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATGTTCTAGTTATAGTAGTGTTGTTGCAATGAAAAATCTACAGGTA[C/T]AATTTTTTTTGATGACACTAACGTGGATTCAAGCATCAGACTTGGATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040035 Nonsense 677 852 4 7
Genomic Location (Zv9):
Chromosome 6 (position 16328981)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16284239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCGCATTAAAGAGATAGAGCAGCAGAGGAAACTTGGAGCTATGTGC[A/T]AGAAAGAAGATAAATCAAGATCGCTAGAGGACTTCCTGTCTAGGTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040035 Nonsense 769 852 7 7
Genomic Location (Zv9):
Chromosome 6 (position 16339991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16295249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGAAGTTCATCAGTGGACCGCGAGGCTCTGTCTGCCTCTCTGGTG[C/T]AGGACATCAGAAACTACTTCCAGATCAGCCTGGAGTATTTCTCCATGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link